rs6017134 chr20:43656816 G>T
- Sequence
cgtgagccacacgcccggcgcagg[G/T]gtgtttttaaattcaaacaagtgt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | n/a | 2.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood