rs6017136 chr20:43657871 G>A
- Sequence
ttgcggttgggtccacccgcctct[G/A]ggcaggccttagcgttcacccgcg
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) HEK293 (embryonic kidney) primary B-CLL cells
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.67 | 1.13 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood