rs6017995 chr20:46708399 A>G
- Sequence
tttgcctgagtgagcattagtggc[A/G]gtgtccccagcctacccctttcct
- ASB in cell types
- pancreas 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.28 | -1.98 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.48 | n/a | 2.00 |
Items per page:
1 – 2 of 2