rs6018241 chr20:47051235 G>A
- Sequence
cattgcagtgtatgcacggtgcac[G/A]tggctggcatcgcagaacgccatc
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 2.70 | -4.61 | 1.50 | -3.66 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol change with statins, ldl cholesterol, urinary albumin-to-creatinine ratio