rs6018425 chr20:47360986 T>C
- Sequence
accttcagagcccggagctgactg[T/C]gtcatgttacagccacaaagaggc
- ASB in cell types
- renal cortex TTC-1240 (Rhabdoid tumor of the kidney) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CREB1_HUMAN ARI1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -1.53 | 1.83 | 1.00 | 4.25 | Concordant | |||
| ARI1A_HUMAN | 2.77 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
