rs6018653 chr20:47712569 G>C
- Sequence
gccgtgctgcactgtagccccagc[G/C]cagtacctggcccagagtgtgcac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.32 | -0.11 | 5.64 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.05 | 1.09 | 1.00 |
Items per page:
1 – 2 of 2