rs6019383 chr20:48705858 T>C
- Sequence
atattatcactaaaattaaacaaa[T/C]aggagaaaataaggcacaccaggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.39 | 1.14 | 5.78 | |||
| MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) | -1.21 | 2.62 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial