rs6019541 chr20:48930280 G>A
- Sequence
tccattcatgagggcagagccctc[G/A]tgacctaatcacttcttaaaggct
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN SUH_HUMAN NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 3.10 | -0.33 | 2.00 | n/a | No Hit | |||
| SUH_HUMAN | 2.57 | n/a | 2.00 | n/a | No Hit | |||
| NOTC1_HUMAN | 1.94 | -4.61 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Stomach, Testis, Thyroid, Whole_Blood