rs6020218 chr20:50033852 T>C
- Sequence
gcttgcaaattccagaacctccag[T/C]gatagctttcgggagcctagattc
- ASB in cell types
- monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocytes from periferal blood | n/a | 2.31 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid