rs6021247 chr20:51492442 G>A
- Sequence
cgcctgctgcgctaaacgtcatcc[G/A]tcatcctttcgctgaaaagttgga
- ASB in cell types
- SYO-1(Biphasic synovial sarcoma)
- ASB for transcription factors
- SSXT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSXT_HUMAN | 1.89 | -1.29 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI cardiovascular disease, diastolic blood pressure, hypertension, mean arterial pressure, medication use (agents acting on the renin-angiotensin system), medication use (calcium channel blockers), medication use (diuretics), systolic blood pressure
GRASP childhood acute lymphoblastic leukemia, diastolic blood pressure (dbp), glycated hemoglobin (hba1c), major depressive disorder, oral cancer in patients with long term tobacco chewing habit, systolic blood pressure (sbp)