rs6021332 chr20:51631210 C>T
- Sequence
ctcttttagaataactttcaaatg[C/T]cccttaatcaccaacaatctttta
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.51 | -0.79 | 2.00 | n/a | No Hit | |||
| SUH_HUMAN | 2.82 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP eye color, fasting blood glucose, hdl cholesterol, homa-ir, infant head circumference, obesity with early age of onset (age >2), premature ovarian failure, sporadic creutzfeldt-jakob disease
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Heart_Left_Ventricle, Whole_Blood