rs6021782 chr20:37903576 G>T
- Sequence
gctcgaaccggcgccagtcgtggc[G/T]ggcatcccggggcgccccctgccg
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.85 | 1.51 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.37 | -0.93 | 1.11 |
Items per page:
1 – 2 of 2