rs6022672 chr20:53693529 T>A
- Sequence
tgtgtataagtgaaattatgcagt[T/A]tgtggccctttgtgtcggtcttca
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.38 | 0.57 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, homa-b