rs6023019 chr20:54199791 T>C
- Sequence
ttcggaaggtggatttgaatgatt[T/C]aagtctggggaacactgtcatgtt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) THP-1 (acute monocytic leukemia) glioblastoma cells GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 3.30 | 0.46 | 1.67 | |||
| THP-1 (acute monocytic leukemia) | 0.78 | 1.09 | 1.00 | |||
| glioblastoma cells | n/a | 0.70 | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 0.48 | 0.33 | 1.17 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, ldl cholesterol change with statins, neuroblastoma (brain cancer), total cholesterol change with statins