rs6025144 chr20:56758894 G>T
- Sequence
tgatctcatcgggcttaaaatcta[G/T]tgtgggggaaacaaacataaagag
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 3.40 | 0.04 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 2.08 | -0.81 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), hdl cholesterol change with statins, triglycerides change with statins