rs6026415 chr20:58628973 G>A
- Sequence
acaaagaggctgagtaactcgtcc[G/A]aagtccagtggtataggccggact
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | -0.09 | 2.36 | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, microalbuminuria, plasma aldosterone concentration, refractive error, rheumatoid arthritis, triglycerides, triglycerides change with statins, urinary albumin-to-creatinine ratio