rs6026584 chr20:58894018 T>C
- Sequence
ctgcagcttaagccagtgacacaa[T/C]attttgcatttttaaatggtgatt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.69 | 1.10 | 1.17 | |||
| K562 (myelogenous leukemia) | -0.08 | 0.58 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, blood urea nitrogen, chronic kidney disease, cystatin c in serum, height, hypertension, combined control dataset, irritible bowel syndrome, major depressive disorder, mitral annular calcium, serum creatinine, transmission distortion, uric acid in serum
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid