rs6026677 chr20:59078448 A>G
- Sequence
ccacctgtctcccattcggagata[A/G]gggaccggttatgacactaacaag
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma)
- ASB for transcription factors
- PBX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX4_HUMAN | 2.56 | -2.35 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, autism with verbal ability, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, mitral annular calcium, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg