rs6026934 chr20:59519658 G>A
- Sequence
tgcagggcttctgcttttacaccc[G/A]aggctcttaaagggagaagaacct
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 2.48 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, fasting insulin, homa-b, homa-ir, ldl cholesterol, triglycerides, waist hip ratio