rs6027258 chr20:38686031 G>A
- Sequence
ttcctcagagacccgggtaattgc[G/A]gctgagctgtccgaggtgctgacg
- ASB in cell types
- Jurkat (T-cells) TTC-1240 (Rhabdoid tumor of the kidney) HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- REST_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 0.79 | 1.59 | 1.41 | n/a | No Hit | |||
| SMCA4_HUMAN | 0.32 | 0.88 | 1.26 | n/a | n/a |
Items per page:
1 – 2 of 2