rs6028079 chr20:61229235 G>C
- Sequence
ttagccaggcctggggaaggacgg[G/C]acgcatcactgctgatgccccttc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19099 (female B-cells Lymphoblastoid Cell Lines) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.37 | 1.67 | 1.33 | |||
| GM02630 (Fanconi anemi) | -0.34 | 1.92 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.34 | -0.90 | 1.00 | |||
| upper lobe of left lung | 1.67 | -1.00 | 1.00 |
Items per page:
1 – 4 of 4