rs6028080 chr20:61229422 A>G
- Sequence
taggtctttgtaaatcaccacctc[A/G]ttttgttcctagagctctgtgtgt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.29 | -1.09 | 1.17 | |||
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | 1.92 | -0.93 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), childhood acute lymphoblastic leukemia, eye color, neuroticism, triglycerides change with statins