rs6029006 chr20:40275224 C>T
- Sequence
gagggaggaggaggaagggaagtg[C/T]tcattgctgctgctcagcccatta
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.71 | -0.08 | 1.80 | -0.24 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, comorbid depressive syndrome and alcohol dependence, eye color, ldl cholesterol change with statins, microalbuminuria, total cholesterol, total cholesterol change with statins, variant creutzfeldt-jakob disease