rs6031580 chr20:44386641 A>G
- Sequence
tataaatgtctggagatagttttg[A/G]ttatcacaccttgagggtagggaa
- ASB in cell types
- erythroid cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.11 | -4.57 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.37 | 0.61 | 1.14 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, infant head circumference, parkinsons disease (pd) (age of onset), premature ovarian failure, simpson-angus scale, triglycerides, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis