rs6031690 chr20:44644749 A>G
- Sequence
aggaagccctctatgctcagcctc[A/G]tctaggctccgccagctccgaggt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.84 | 0.35 | 1.13 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.31 | 1.05 | 1.20 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cortex, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood