rs6032067 chr20:45236168 G>T
- Sequence
tctacaggaccagagtcacagcca[G/T]tcctgtatccacacttgatgctgc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.47 | 2.05 | 1.00 |
Items per page:
1 – 1 of 1