rs60352530 chr1:47333764 G>A
- Sequence
cgcggaccgcacgagtgtcgccga[G/A]acgccgccgccgtgcgaagctcct
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- TYY1_HUMAN BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -0.05 | 2.50 | 1.80 | n/a | No Hit | |||
| BRD2_HUMAN | 1.67 | -0.08 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid