rs6036910 chr20:24781621 C>T
- Sequence
gggagggcggctaagagggcaggg[C/T]tgggggctgtgcagagtccaggtc
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.67 | -1.03 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 1.02 | -0.33 | 1.50 |
Items per page:
1 – 2 of 2