rs60371891 chr8:138686638 G>C
- Sequence
cctggaggttcctttccaaatccc[G/C]ggcccggccctcagcctgggcctc
- ASB in cell types
- keratinocytes IMR-5 (Neuroblastoma) A549 (lung carcinoma) gastroesophageal sphincter
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -1.43 | 2.50 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1