rs6037767 chr20:4119674 T>C
- Sequence
ttctgacttgagcaactggattga[T/C]gtgagtgccttcagtgagtcagat
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.31 | -0.20 | 1.21 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.54 | 1.68 | 1.60 |
Items per page:
1 – 2 of 2