rs6039944 chr20:10453529 A>T
- Sequence
attttggtgaagcacatctttagt[A/T]gcttcctgagaaaaaatacatgaa
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REQU_HUMAN | 0.06 | 2.07 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1