rs6040065 chr20:10662403 C>T
- Sequence
ggtgctgtgaatgctgcagtgtgg[C/T]ggggaggtctctcacatgtcccta
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.46 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), height, obesity with early age of onset (age >2), schizophrenia, spine bone mineral density (bmd), stabilized warfarin dose, type 2 diabetes