rs6040427 chr20:11205318 T>C
- Sequence
atactaggaagttggttcgtaaga[T/C]cactttcccaactgctacgccctc
- ASB in cell types
- sigmoid colon GM12878 (female B-cells lymphoblastoid cell line) hASC (preadipocytes) D54 (H54, Human glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| sigmoid colon | 2.52 | -2.19 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.00 | -1.42 | 1.00 | |||
| hASC (preadipocytes) | 1.70 | 0.23 | 1.00 | |||
| D54 (H54, Human glioblastoma) | -2.64 | 1.42 | 1.50 |
Items per page:
1 – 4 of 4