rs6042211 chr20:13546610 C>T
- Sequence
aattcttgtgatgagggtccattc[C/T]ttttcttggcggtgtggggaagac
- ASB in cell types
- FT282 (normal human fallopian tube tissue) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| FT282 (normal human fallopian tube tissue) | 1.82 | -1.78 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.65 | 0.70 | 1.13 |
Items per page:
1 – 2 of 2