rs6042668 chr20:1503715 G>C
- Sequence
ctggagacctgtcaacccttctct[G/C]ggaatgcacccttttgggacttag
- ASB in cell types
- epidermal keratinocytes GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.59 | 0.50 | 2.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.47 | 0.41 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp)