rs6043624 chr20:15930679 G>A
- Sequence
atactgcaaatagaaaacagtgcc[G/A]ctgagactcaaagagaaaacaaaa
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.99 | 0.11 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, fasting blood glucose, fasting insulin, hdl cholesterol, homa-ir, triglycerides