rs6044054 chr20:16518662 A>T
- Sequence
cttgtttaatgatctttaatttac[A/T]tgactgtagatttaagttgctcat
- ASB in cell types
- foreskin keratinocyte MS-1 (Small cell lung carcinoma) neural cell LUHMES (lund human mesencephalic cells)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 2.11 | 0.50 | 1.88 | n/a | n/a |
Items per page:
1 – 1 of 1