rs6044386 chr20:16821784 G>A
- Sequence
cattctctacagtcacagcccctg[G/A]tcgggggtggggggttaaagtaaa
- ASB in cell types
- MDA-MB-157 (triple negative breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-157 (triple negative breast carcinoma) | -1.83 | 2.22 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, ldl cholesterol, multiple sclerosis, total cholesterol, triglycerides change with statins