rs60460416 chr17:78445748 G>T
- Sequence
acgtcagcagccctgaagatgcgc[G/T]ctggactcgaagaggagttcacac
- ASB in cell types
- T47D (invasive ductal carcinoma) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.54 | 1.27 | 1.10 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.80 | 1.05 | 1.00 |
Items per page:
1 – 2 of 2