rs6046489 chr20:19964849 T>C
- Sequence
tctgataagccacacggtagtttg[T/C]ttgagagtactcagatggtcccac
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma) MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.13 | -0.43 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, neuroblastoma (brain cancer), tetrology of fallot, urinary albumin-to-creatinine ratio