rs604751 chr15:40906696 A>G
- Sequence
gggcaccagccctggagagggcac[A/G]gggctcagcgtggccagctcggat
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.02 | 1.30 | 1.17 | |||
| T47D (invasive ductal carcinoma) | 0.25 | 0.92 | 1.98 |
Items per page:
1 – 2 of 2