rs6049644 chr20:24389964 A>G
- Sequence
gcttgccagtccctgaagcggagt[A/G]ctcccctcaccccacccctatctt
- ASB in cell types
- macrophages form periferal blood MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -4.23 | 2.49 | 2.00 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -0.47 | 1.31 | 1.00 |
Items per page:
1 – 2 of 2