rs6050907 chr20:2652053 A>C
- Sequence
agtacgaagaaaactgcgcgagct[A/C]cattcccagcagggtctgcgccag
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.89 | 0.25 | 1.95 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.70 | 0.91 | 1.10 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Heart_Left_Ventricle, Lung, Nerve_Tibial, Testis