rs6051787 chr20:3358787 T>C
- Sequence
ttaaatattgttcctcactaattg[T/C]actgaagctctttggtgaaatggc
- ASB in cell types
- liver VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.70 | -0.64 | 1.00 | |||
| VCaP (prostate carcinoma) | 1.74 | -1.44 | 1.00 |
Items per page:
1 – 2 of 2