rs6052008 chr20:437623 G>C
- Sequence
ctatttgggagtaggatgatttga[G/C]gaaaacaggaagaaaaaccggtca
- ASB in cell types
- HT1080 (fibrosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT1080 (fibrosarcoma) | 2.42 | -2.16 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1/fvc ratio (in nonasthmatic participants), homa-b, homa-ir, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in nonasthmatic participants), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid