rs6052678 chr20:4607401 T>C
- Sequence
gaccactttggaatgtgttgaccc[T/C]gcactgcttttactcaacactagg
- ASB in cell types
- upper lobe of left lung neutrophils liver GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 1.19 | -0.35 | 1.00 | |||
| neutrophils | 0.34 | 3.07 | 1.50 | |||
| liver | -5.04 | 2.96 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.62 | 1.00 | 1.11 | |||
| esophagus squamous epithelium | 0.79 | -0.22 | 1.00 |
Items per page:
1 – 5 of 6