rs6054641 chr20:6977957 T>C
- Sequence
tttgatgatgttgggcaatctggt[T/C]ctgtctaaaatatctgccaggcag
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 2.44 | -5.29 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), body mass index (bmi), hdl cholesterol change with statins, height, homa-b, salmonella-induced pyroptosis, total cholesterol