rs6055570 chr20:8148677 C>A
- Sequence
ttcatcagtggatgaatggataaa[C/A]aagacatggcatatacataaatgg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- ERG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERG_HUMAN | 2.69 | -2.43 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, hdl cholesterol, homa-b, homa-ir, infant head circumference, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), paternal transmission distortion, total cholesterol, transmission distortion, years of education