rs6056570 chr20:9354129 G>A
- Sequence
aatatcctcttacccaacctccct[G/A]cagctgcctgcattgcttttatgt
- ASB in cell types
- MDM(monocyte derived macrophages)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.25 | -4.71 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, body mass index (bmi), fasting insulin, hip bone mineral density (bmd), homa-b, homa-ir, ldl cholesterol, longstanding arthritis, parkinsons disease, spine bone mineral density (bmd), total cholesterol