rs6056996 chr20:9903299 G>T
- Sequence
aagtgatttatagatgatcttgtt[G/T]taacaaaataaaaccatgtaaaat
- ASB in cell types
- MS-1 (Small cell lung carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.73 | -1.73 | 1.00 | |||
| VCaP (prostate carcinoma) | 2.42 | -2.16 | 1.00 |
Items per page:
1 – 2 of 2